|
ИСТИНА |
Войти в систему Регистрация |
Интеллектуальная Система Тематического Исследования НАукометрических данных |
||
[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene]статья
Информация о цитировании статьи получена из
Scopus
Дата последнего поиска статьи во внешних источниках: 5 августа 2018 г.
- Авторы: Boni I.V., Isaeva D.M., Budovskiĭ E.I.
- Журнал: Bioorganicheskaia khimiia
- Том: 12
- Номер: 2
- Год издания: 1986
- Первая страница: 293
- Последняя страница: 296
- Аннотация: The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.
- Добавил в систему: Бони Ирина Венедиктовна